X-Authentication-Warning: delorie.com: mail set sender to djgpp-bounces using -f From: Rich Organization: MIBnet User-Agent: Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.5) Gecko/20031013 Thunderbird/0.3 X-Accept-Language: en-us, en MIME-Version: 1.0 Newsgroups: comp.os.msdos.djgpp Subject: Re: LFN support for XP? References: <3FACD610 DOT 834713DD AT phekda DOT freeserve DOT co DOT uk> In-Reply-To: X-Enigmail-Version: 0.81.7.0 X-Enigmail-Supports: pgp-inline, pgp-mime Content-Type: text/plain; charset=us-ascii; format=flowed Content-Transfer-Encoding: 7bit X-Forwarded: for mibnet.plus.com via NNTP Proxy Lines: 46 Message-ID: Date: Tue, 11 Nov 2003 07:49:20 +0000 NNTP-Posting-Host: 212.159.3.244 X-Complaints-To: abuse AT plus DOT net DOT uk X-Trace: wards.force9.net 1068536998 212.159.3.244 (Tue, 11 Nov 2003 07:49:58 GMT) NNTP-Posting-Date: Tue, 11 Nov 2003 07:49:58 GMT X-Received-Date: Tue, 11 Nov 2003 08:48:44 MET (news01.chello.no) To: djgpp AT delorie DOT com DJ-Gateway: from newsgroup comp.os.msdos.djgpp Reply-To: djgpp AT delorie DOT com -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Tim Boston randomly hit the keyboard and managed to write on 10/11/2003 17:36: | Hi, | | I'm using the default install of DJGPP 2.03 currently available from | www.delorie.com. | | If I create a file called test.c like so: | int main() { return 0; } | | ....this compiles fine. | | If I rename the file to testtesttest.c and compile it, I get this: | | cc1.exe: testtesttest.c: No such file or directory (ENOENT) | | Changing the LFN setting in DJGPP.ENV doesn't affect anything, nor does | manually setting LFN=y (or LFN=n) as an environment variable prior to | compiling... | | Tim. | You are using cmd.exe and not command.com as the shell? Richard - -- - ------------------------------------------------------------------------ ~ My Reply-To address will blacklist you. Use the one below. - ------------------------------------------------------------------------ CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/sJSADehCPPrjI9gRAsA3AJ9R5ufTJd1e9N1RNfK3ddAc+66kqgCgmCM7 QdtRY1qjr9gBanlLV3EtR2k= =oDKP -----END PGP SIGNATURE-----