From: "Richard Thomas Harrison" Newsgroups: comp.os.msdos.djgpp References: Subject: Re: call to 'open' causes all sleeping drives to awaken! Lines: 29 Organization: MIBnet MIME-Version: 1.0 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: 7bit X-Priority: 3 X-MSMail-Priority: Normal X-Newsreader: Microsoft Outlook Express 6.00.2720.3000 X-MimeOLE: Produced By Microsoft MimeOLE V6.00.2600.0000 Message-ID: Date: Thu, 20 Feb 2003 06:00:50 -0000 NNTP-Posting-Host: 195.166.145.95 X-Complaints-To: abuse AT plus DOT net DOT uk X-Trace: wards 1045721034 195.166.145.95 (Thu, 20 Feb 2003 06:03:54 GMT) NNTP-Posting-Date: Thu, 20 Feb 2003 06:03:54 GMT To: djgpp AT delorie DOT com DJ-Gateway: from newsgroup comp.os.msdos.djgpp Reply-To: djgpp AT delorie DOT com "Sander Pool" wrote in message news:b2v0tc02dt0 AT enews4 DOT newsguy DOT com... > Hello, > > I noticed when I used a program compiled with DJGPP that all sleeping drives > in my system spin up. I examined the code and it only uses the 'open' call > to create file descriptors. So I wrote a tiny test program: > ---8<--- > > PPS Win2K One thing I find is that XP keeps waking up my CDROMS just to check something is there. What's the whole point of Autorun then ? I have to keep a CD in both of the drives otherwise XP locks up the system for about 15 seconds and then returns control for about 10 seconds before locking up again. Sigh... I gonna have to get around to re-installing Linux. ;^) Richard -- ------------------------------------------------------------------------ CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rth @ mibnet.plus.com